WHP Posttranscriptional Response Element

id: whp-posttranscriptional-response-element-269-1675984
title: WHP Posttranscriptional Response Element
text: Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE) is a DNA sequence that, when transcribed, creates a tertiary structure enhancing expression. The sequence is commonly used in molecular biology to increase expression of genes delivered by viral vectors. WPRE is a tripartite regulatory element with gamma, alpha, and beta components. The alpha component is 80bp long: GCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGT When used alone without
brand slug: wiki
category slug: encyclopedia
description: DNA Sequence
original url: https://en.wikipedia.org/wiki/WHP_Posttranscriptional_Response_Element
date created:
date modified: 2024-03-16T23:09:14Z
main entity: {"identifier":"Q7950381","url":"https://www.wikidata.org/entity/Q7950381"}
image:
fields total: 13
integrity: 14

Related Entries

Explore Next Part